ID: 961432757_961432763

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 961432757 961432763
Species Human (GRCh38) Human (GRCh38)
Location 3:126894648-126894670 3:126894683-126894705
Sequence CCATCACGGTGGGAGGCAGACTG CAGCAGACGGAGCAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 198} {0: 1, 1: 1, 2: 5, 3: 57, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!