ID: 961450772_961450786

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 961450772 961450786
Species Human (GRCh38) Human (GRCh38)
Location 3:127001392-127001414 3:127001429-127001451
Sequence CCAGGGTCCATCAGCTCAGGCTG CCAGGGGCAAGAGGGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 21, 4: 249} {0: 1, 1: 0, 2: 5, 3: 44, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!