ID: 961474277_961474292

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 961474277 961474292
Species Human (GRCh38) Human (GRCh38)
Location 3:127136968-127136990 3:127137021-127137043
Sequence CCTCTGTCCCCCAGCTCATCCTC CACAGTTTCAGTCCTAAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 70, 4: 662} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!