ID: 961480128_961480135

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 961480128 961480135
Species Human (GRCh38) Human (GRCh38)
Location 3:127174204-127174226 3:127174245-127174267
Sequence CCCATCTCTCTACCTCAGCATTC CTGCACTGCACCTCTGCTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!