ID: 961491203_961491219

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 961491203 961491219
Species Human (GRCh38) Human (GRCh38)
Location 3:127257853-127257875 3:127257887-127257909
Sequence CCATCAGCCCCCAGCCTCCAGCT AGGCTCTGAGCGGGTGGTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 44, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!