ID: 961538804_961538816

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 961538804 961538816
Species Human (GRCh38) Human (GRCh38)
Location 3:127586771-127586793 3:127586820-127586842
Sequence CCAGGGTGCAGGCCAGGCACCCA CTTGAGGCACAGAGGCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 434} {0: 1, 1: 0, 2: 0, 3: 32, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!