ID: 961551202_961551211

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 961551202 961551211
Species Human (GRCh38) Human (GRCh38)
Location 3:127671597-127671619 3:127671618-127671640
Sequence CCAAGCTCAAGCACGTGGTGAGT GTGTGGGGACAGGTGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} {0: 1, 1: 0, 2: 5, 3: 80, 4: 727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!