ID: 961552946_961552958

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 961552946 961552958
Species Human (GRCh38) Human (GRCh38)
Location 3:127679550-127679572 3:127679591-127679613
Sequence CCTCTGTCCCACCATTCTGACAG GTTATCTATACCTCATGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186} {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!