ID: 961555133_961555134

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 961555133 961555134
Species Human (GRCh38) Human (GRCh38)
Location 3:127691970-127691992 3:127691986-127692008
Sequence CCTTTCTCTTTTTTTGCATAAAG CATAAAGTGTCTAACCATTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 770} {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!