ID: 961588713_961588721

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 961588713 961588721
Species Human (GRCh38) Human (GRCh38)
Location 3:127958507-127958529 3:127958535-127958557
Sequence CCCAGTGCTGGGTTGACACAAAA GGTATCACTCAGGATCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 142} {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!