ID: 961591836_961591849

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 961591836 961591849
Species Human (GRCh38) Human (GRCh38)
Location 3:127987025-127987047 3:127987073-127987095
Sequence CCCAGTGGAACTTTCCAGAGAGT TGACCTCTGCTGGAGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170} {0: 1, 1: 0, 2: 3, 3: 28, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!