ID: 961609205_961609221

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 961609205 961609221
Species Human (GRCh38) Human (GRCh38)
Location 3:128123410-128123432 3:128123456-128123478
Sequence CCAGCTCCAGGGCGGCGCCCCTC CTTCCCTGAGGAAATAATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 275} {0: 1, 1: 0, 2: 2, 3: 36, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!