|
Left Crispr |
Right Crispr |
| Crispr ID |
961613219 |
961613222 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:128157599-128157621
|
3:128157636-128157658
|
| Sequence |
CCTGTGCTCTTGAAATGGCACAA |
CAGCACATCTGTTTATAGCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 53, 3: 324, 4: 699} |
{0: 57, 1: 352, 2: 540, 3: 527, 4: 491} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|