|
Left Crispr |
Right Crispr |
| Crispr ID |
961617087 |
961617093 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:128191395-128191417
|
3:128191426-128191448
|
| Sequence |
CCCACCTTAGCCTCTTGAGTAGC |
CAGCTCACTGTGCCTGGCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 67, 1: 2191, 2: 24206, 3: 126906, 4: 217733} |
{0: 1, 1: 1, 2: 3, 3: 37, 4: 418} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|