ID: 961629129_961629136

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 961629129 961629136
Species Human (GRCh38) Human (GRCh38)
Location 3:128283489-128283511 3:128283515-128283537
Sequence CCCTCCAGGCAGCCCACGTCTTG AACCCTAGGCAGCTCCAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 127} {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!