ID: 961630861_961630867

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 961630861 961630867
Species Human (GRCh38) Human (GRCh38)
Location 3:128297353-128297375 3:128297391-128297413
Sequence CCTTTCTTTATTTGTGGATTGAG GCTGTAGTTTCCTTTGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 347} {0: 1, 1: 1, 2: 3, 3: 25, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!