ID: 961633982_961633987

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 961633982 961633987
Species Human (GRCh38) Human (GRCh38)
Location 3:128321494-128321516 3:128321520-128321542
Sequence CCAGGACAGTCTCTGGGCAGACC TGGGGTGCATCCTGCTAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 196} {0: 1, 1: 0, 2: 1, 3: 5, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!