ID: 961635494_961635503

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 961635494 961635503
Species Human (GRCh38) Human (GRCh38)
Location 3:128330321-128330343 3:128330354-128330376
Sequence CCAGATCATTCCCTTCCTCTCAG ATGTGGCAGGCACTGTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 410} {0: 1, 1: 8, 2: 84, 3: 339, 4: 1216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!