ID: 961636455_961636461

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 961636455 961636461
Species Human (GRCh38) Human (GRCh38)
Location 3:128335916-128335938 3:128335937-128335959
Sequence CCCTGACATCAGAGCGTTGCCCT CTGGAGAAGCAGAAGGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 6, 3: 45, 4: 551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!