ID: 961647855_961647870

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 961647855 961647870
Species Human (GRCh38) Human (GRCh38)
Location 3:128401959-128401981 3:128402007-128402029
Sequence CCTAGAGATGTCAGCGAGCTTTC CTGTGTGCCATGGATTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93} {0: 1, 1: 1, 2: 3, 3: 38, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!