ID: 961698856_961698866

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 961698856 961698866
Species Human (GRCh38) Human (GRCh38)
Location 3:128726303-128726325 3:128726338-128726360
Sequence CCTCGGCGGGAGCCCTCGCGACG AGCCCCCAGCGCAGCGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 60} {0: 1, 1: 0, 2: 0, 3: 34, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!