ID: 961723283_961723291

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 961723283 961723291
Species Human (GRCh38) Human (GRCh38)
Location 3:128909814-128909836 3:128909841-128909863
Sequence CCCTCCCTGAATCTAGAGCTCAA AAGGGAAAACAGAAGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120} {0: 1, 1: 0, 2: 3, 3: 71, 4: 1007}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!