ID: 961739271_961739288

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 961739271 961739288
Species Human (GRCh38) Human (GRCh38)
Location 3:129022617-129022639 3:129022658-129022680
Sequence CCCAACCGCACACAAGGACTCTG GGGTGTGAGGGGAGGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 2, 1: 2, 2: 32, 3: 460, 4: 3815}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!