ID: 961761247_961761251

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 961761247 961761251
Species Human (GRCh38) Human (GRCh38)
Location 3:129169969-129169991 3:129170016-129170038
Sequence CCACTCAACTGTATGTTCTATGT ATGTTATTTAATAGCTACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 205} {0: 1, 1: 0, 2: 0, 3: 25, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!