ID: 961795140_961795149

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 961795140 961795149
Species Human (GRCh38) Human (GRCh38)
Location 3:129403722-129403744 3:129403761-129403783
Sequence CCAAAGGAGGCCATTTTCTTAGA CTCTCGAAAGGGCTGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 189} {0: 1, 1: 0, 2: 1, 3: 15, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!