ID: 961809778_961809785

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 961809778 961809785
Species Human (GRCh38) Human (GRCh38)
Location 3:129515085-129515107 3:129515111-129515133
Sequence CCATCTTTCTGCACCTTGGGTTC CTTTCCCACAGGTAGTTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 257} {0: 1, 1: 0, 2: 0, 3: 18, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!