ID: 961818865_961818870

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 961818865 961818870
Species Human (GRCh38) Human (GRCh38)
Location 3:129565121-129565143 3:129565138-129565160
Sequence CCGTTGAGCCCTTGCAGCAAGCC CAAGCCAGCCAGGCTTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 141} {0: 1, 1: 0, 2: 3, 3: 39, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!