ID: 961820600_961820612

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 961820600 961820612
Species Human (GRCh38) Human (GRCh38)
Location 3:129573838-129573860 3:129573867-129573889
Sequence CCGTGCAGACCCACTGCTTAGAG CTGGAGGCTCAGGTGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167} {0: 1, 1: 0, 2: 5, 3: 92, 4: 733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!