ID: 961874547_961874551

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 961874547 961874551
Species Human (GRCh38) Human (GRCh38)
Location 3:130011702-130011724 3:130011725-130011747
Sequence CCCCACCAGAAGGAATAAGCTTC GAATACATCTGAACATCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 8, 3: 66, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!