ID: 961884998_961885003

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 961884998 961885003
Species Human (GRCh38) Human (GRCh38)
Location 3:130091244-130091266 3:130091291-130091313
Sequence CCATGATTTCATTGCAGGGCTGT TTTCTTTAAAGAGGCACCTCTGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 0, 3: 10, 4: 161} {0: 3, 1: 4, 2: 4, 3: 15, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!