ID: 961909788_961909797

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 961909788 961909797
Species Human (GRCh38) Human (GRCh38)
Location 3:130302535-130302557 3:130302574-130302596
Sequence CCAGTACCACCAGGAATGGGGTC AGTCAAACCTGTGTTCATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 19, 4: 126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!