ID: 961917262_961917268

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 961917262 961917268
Species Human (GRCh38) Human (GRCh38)
Location 3:130390273-130390295 3:130390324-130390346
Sequence CCTAAGTATCAGGTCATGACTAG AGGTTTTTACAGATACAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 52} {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!