ID: 961972579_961972583

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 961972579 961972583
Species Human (GRCh38) Human (GRCh38)
Location 3:130986068-130986090 3:130986101-130986123
Sequence CCAGTATGTTGGGATCATAGATG TCACTGCCACCCAGAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 651} {0: 1, 1: 1, 2: 1, 3: 82, 4: 1967}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!