ID: 961975614_961975619

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 961975614 961975619
Species Human (GRCh38) Human (GRCh38)
Location 3:131022133-131022155 3:131022168-131022190
Sequence CCATATCTTGGGGCTTCCCTGAG TAAGTAGGATGTCCCTTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 205} {0: 1, 1: 0, 2: 2, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!