ID: 961983840_961983841

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 961983840 961983841
Species Human (GRCh38) Human (GRCh38)
Location 3:131110988-131111010 3:131111012-131111034
Sequence CCAAAGCTACTGACTGTAAAACT CTGTGTACATACATTTATATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 157} {0: 1, 1: 0, 2: 0, 3: 44, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!