ID: 961985026_961985033

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 961985026 961985033
Species Human (GRCh38) Human (GRCh38)
Location 3:131122815-131122837 3:131122837-131122859
Sequence CCTGGATGCTGGGGAAGAATGAC CCTGATGGGGAGATGGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223} {0: 1, 1: 0, 2: 4, 3: 45, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!