ID: 962069213_962069214

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 962069213 962069214
Species Human (GRCh38) Human (GRCh38)
Location 3:132015743-132015765 3:132015771-132015793
Sequence CCATTGAAGGGATCAAATGGAAC CAGAGAAATGCCAGCCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106} {0: 1, 1: 0, 2: 1, 3: 24, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!