|
Left Crispr |
Right Crispr |
| Crispr ID |
962073940 |
962073943 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:132060691-132060713
|
3:132060735-132060757
|
| Sequence |
CCTTTTTTCCACAACCTCAGCAG |
TTAATAGCAGCCATTCTGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 302, 3: 1225, 4: 3065} |
{0: 12, 1: 363, 2: 1930, 3: 4456, 4: 6274} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|