ID: 962086169_962086170

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 962086169 962086170
Species Human (GRCh38) Human (GRCh38)
Location 3:132194153-132194175 3:132194169-132194191
Sequence CCAGTGCAGGGCAAAGCAGACTC CAGACTCTAGTGACTAGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163} {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!