ID: 962100588_962100590

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 962100588 962100590
Species Human (GRCh38) Human (GRCh38)
Location 3:132338172-132338194 3:132338220-132338242
Sequence CCAATTTCCTTATGCATATACAA CTTCTTTTGTTACACGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 326} {0: 1, 1: 0, 2: 0, 3: 18, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!