ID: 962105772_962105781

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 962105772 962105781
Species Human (GRCh38) Human (GRCh38)
Location 3:132387419-132387441 3:132387469-132387491
Sequence CCTGCTCTTCACTACGGTCATGG AGGGGTATTATCTACAGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 66} {0: 1, 1: 1, 2: 1, 3: 5, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!