ID: 962137781_962137783

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 962137781 962137783
Species Human (GRCh38) Human (GRCh38)
Location 3:132755810-132755832 3:132755823-132755845
Sequence CCTAGTCATGTGTAAGAGGGACC AAGAGGGACCAGAAGCAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 71, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!