ID: 962152573_962152577

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 962152573 962152577
Species Human (GRCh38) Human (GRCh38)
Location 3:132908372-132908394 3:132908403-132908425
Sequence CCAATAAAGATGTGGAACACTTC CCCAAAATTGCTGTCATTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 14, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!