ID: 962169451_962169454

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 962169451 962169454
Species Human (GRCh38) Human (GRCh38)
Location 3:133085350-133085372 3:133085374-133085396
Sequence CCTTGCCCACTATGGTGCTTATT ACTTTATTTTACTTTTATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132} {0: 1, 1: 4, 2: 11, 3: 138, 4: 1287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!