|
Left Crispr |
Right Crispr |
| Crispr ID |
962181047 |
962181052 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:133206842-133206864
|
3:133206874-133206896
|
| Sequence |
CCACTGCTCCCTTCAGAGCTGGC |
CACTTAAGTCTGCTGAAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 121, 2: 859, 3: 3323, 4: 2999} |
{0: 2, 1: 2, 2: 11, 3: 22, 4: 129} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|