ID: 962182974_962182979

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 962182974 962182979
Species Human (GRCh38) Human (GRCh38)
Location 3:133227491-133227513 3:133227514-133227536
Sequence CCTAAGGAAGGCCTTTCTAACCA TGGTAGAGTGTCTGTGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168} {0: 1, 1: 0, 2: 1, 3: 11, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!