ID: 962185810_962185816

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 962185810 962185816
Species Human (GRCh38) Human (GRCh38)
Location 3:133258368-133258390 3:133258408-133258430
Sequence CCATCAAGCTACAAGAAGGGCAT GCATACCATGTGGTGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 134} {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!