ID: 962204435_962204458

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 962204435 962204458
Species Human (GRCh38) Human (GRCh38)
Location 3:133423511-133423533 3:133423548-133423570
Sequence CCAGCCAACTTTTCCGTACTTTG GGTGGTGGGGGAGGCGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 192} {0: 1, 1: 4, 2: 124, 3: 1188, 4: 9328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!