ID: 962204435_962204461

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 962204435 962204461
Species Human (GRCh38) Human (GRCh38)
Location 3:133423511-133423533 3:133423553-133423575
Sequence CCAGCCAACTTTTCCGTACTTTG TGGGGGAGGCGGCGGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 192} {0: 1, 1: 1, 2: 58, 3: 559, 4: 3596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!