|
Left Crispr |
Right Crispr |
| Crispr ID |
962206576 |
962206579 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:133440000-133440022
|
3:133440039-133440061
|
| Sequence |
CCTGAGACTGGGTAATTCATAAA |
AACCCACAGTTCCCCACGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 172, 1: 6943, 2: 13513, 3: 14104, 4: 10977} |
{0: 1, 1: 0, 2: 19, 3: 475, 4: 4707} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|